talA

Information for talA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2574118-2576397 - CDS b2463 EG14193 putative multimodular enzyme 2576686-2577636 + CDS talA EG11797 transaldolase A 2577656-2579659 + CDS tktB EG12100 transketolase 2 isozyme

Reported regulatory sites for talA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.954 2576632-2576655 tctca GAAGTGTGAATTAACGCACTCATC taaca - 0 - 4.162 2576494-2576517 tctac AGACTTTGAGCAAGTCCAAACTCT cacca - 0 - 3.922 2576583-2576603 gcaat ACCATGCCTGTCTGCTATGCT ttttt - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back