talB

Information for talB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 6529-7959 - CDS yaaJ EG11555 inner membrane transport protein 8238-9191 + CDS talB EG11556 transaldolase B 9306-9893 + CDS mog EG11511 required for the efficient incorporation of molybdate into molybdoproteins

Reported regulatory sites for talB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.535 8171-8191 cgttg CGTCGTGATATCATCAGGGCA gaccg - 0 - 1.739 8213-8236 ctaac AAGCTGTTTAAAGAGAAATACTAT catga - 0 - 1.087 8001-8017 tgtgt AAACGTTACCAATTGTT taaga - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back