tar

Information for tar, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1967407-1969008 - CDS tap EG10987 methyl-accepting chemotaxis protein IV; peptide sensor receptor 1969054-1970715 - CDS tar EG10988 methyl-accepting chemotaxis protein II; aspartate sensor receptor 1970860-1971363 - CDS cheW EG10149 positive regulator of CheA protein activity

Reported regulatory sites for tar: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.312 1970746-1970769 R ataaa GTTTCCCCCCTCCTTGCCGATAAC gagat - 0 - 1.787 1970721-1970739 R agatc AACTTGTTTTCAGGAAGGT gcctt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back