tbpA

Information for tbpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 72911-74521 - CDS yabK EG11573 putative transport system permease protein 74497-75480 - CDS tbpA EG11574 thiamin-binding periplasmic protein 75644-77299 - CDS yabN EG12094 putative transport protein

Reported regulatory sites for tbpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.137 75532-75555 R cgaac CTGATCCGGATAACGCCGGCGAAG ggatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.317 75559-75578 R gcgtg CGCTGAGAAAATACCCGTCG aacct - 0 - 1.556 75585-75602 R ttctc AACGGGGTGCCACGCGTA cgcgt - 0 - 1.556 75494-75511 R tctca AGTCCTTTGCCACTCTTT tttga - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back