tdcA

Information for tdcA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3262680-3263669 - CDS tdcB EG10990 threonine dehydratase; catabolic 3263768-3264706 - CDS tdcA EG10989 transcriptional activator of tdc operon 3264895-3265239 + CDS tdcR EG10992 threonine dehydratase operon activator protein

Reported regulatory sites for tdcA: Genome coordinates Source Transcription factor Transcription factor annotation 3264767-3264788 DPInteract crp cyclic AMP receptor protein 3264814-3264861 DPInteract ihf integration host factor (IHF)

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.875 3264769-3264788 R agtta ATTTGTGAGTGGTCGCACAT atcct crp 20 - 3.892 3264860-3264883 R tgaca AAAATCAGGGTTTATGCTGATTTT tatac ihf 2 - - 1.943 3264715-3264736 R tcatg CCGTCAATGAGGTAATTAACGT aggtc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back