tdcB

Information for tdcB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3261327-3262658 - CDS tdcC EG10991 anaerobically inducible L-threonine; L-serine permease 3262680-3263669 - CDS tdcB EG10990 threonine dehydratase; catabolic 3263768-3264706 - CDS tdcA EG10989 transcriptional activator of tdc operon

Reported regulatory sites for tdcB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.826 3263700-3263716 R aggtg TCGGTTACGGTTACCTA catat - 0 - 1.376 3263745-3263764 R agtta TTTGTTTTTATTTAAACATA aataa - 0 - 1.192 3263729-3263751 R tattt AAACATAAATAATCCACCTGTCT gtctt - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back