tesB

Information for tesB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 472190-473476 + CDS amtB EG11821 probable ammonium transporter 473525-474385 - CDS tesB EG10995 acyl-CoA thioesterase II 474603-475175 + CDS ybaY EG13253 glycoprotein/polysaccharide metabolism

Reported regulatory sites for tesB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.460 474530-474549 R gaaga GTGGTTAACAAAATAGTAAC gtcaa - 0 - 1.460 474463-474482 R agccc GTAATTCAGACCATTGCACC catcg - 0 - 1.305 474501-474524 R gtcaa CAAGTGTGGCACACATCACGCATT tctgc - 0 - 1.305 474421-474444 R gcaaa TTTGCGTTATACTCAACTCACTTT ggctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back