thiL

Information for thiL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 434361-434780 + CDS nusB EG10666 transcription termination; L factor 434858-435835 + CDS thiL EG20227 thiamin-monophosphate kinase 435813-436331 + CDS pgpA EG10704 phosphatidylglycerophosphatase

Reported regulatory sites for thiL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.652 434833-434856 ttttc TTTTTTACCTGCTGAGGCATAACG tatgg - 0 - 0.951 434816-434831 ttcca TGATCGCCGGCCTTTT ctttt - 0 - 0.548 434803-434823 tcacg GAAGACCGTTCCATGATCGCC ggcct - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back