thiM

Information for thiM, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2181736-2182536 - CDS thiD EG14068 phosphomethylpyrimidine kinase 2182533-2183321 - CDS thiM EG14069 hydoxyethylthiazole kinase 2183544-2183816 - CDS yohL EG14070 orf; hypothetical protein

Reported regulatory sites for thiM: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.771 2183388-2183411 R agaaa TACCCGTATCACCTGATCTGGATA atgcc - 0 - 2.767 2183408-2183426 R tctgc GTGAAGGCTGAGAAATACC cgtat - 0 - 2.580 2183509-2183530 R cgcga TTGTAAAACTGCCGTTTTTCCT cgttt - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back