tig

Information for tig, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 453663-454013 + CDS bolA EG10125 possible regulator of murein genes 454357-455655 + CDS tig EG11003 trigger factor; a molecular chaperone involved in cell division 455901-456524 + CDS clpP EG10158 ATP-dependent proteolytic subunit of clpA-clpP serine protease; heat shock protein F21.5

Reported regulatory sites for tig: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.597 454068-454089 tatga AAAACGGCCTGCGGGCCGTTTT gtttt - 0 - 3.833 454277-454294 aagaa CATCCCGGTTCCGCGAAG ccaac - 0 - 3.660 454201-454219 gtgat GCCGCTATAATGCCGCGTC ctatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back