tldD

Information for tldD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3387155-3388084 + CDS yhcS EG12825 putative transcriptional regulator LYSR-type 3388218-3389663 - CDS tldD EG12826 suppresses inhibitory activity of CsrA 3390094-3393054 - CDS yhdP EG12827 orf; hypothetical protein

Reported regulatory sites for tldD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.219 3389989-3390012 R aggtc GGATAGGGCGTTCACGCCGCATCC ggcag - 0 REP245g (24) 2.219 3389714-3389737 R aggct GGATAGGGCGTTCACGCCGCATCC ggcag - 0 REP245a (24) 1.896 3389861-3389883 R tgcct GATGCGACGCTGTGCGTCTTATC aggcc - 0 REP245d (23) 1.896 3389769-3389791 R tgcct GATGCGACGCTGTGCGTCTTATC aggcc - 0 REP245b (23) 1.192 3389902-3389925 R ccgta GGTCGGATAAGGCGTTTACGCCGC atccg - 0 REP245e (24) 1.192 3389811-3389834 R ccgta GGTCGGATAAGGCGTTTACGCCGG catcc - 0 REP245c (24)

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back