tolA

Information for tolA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 775072-775500 + CDS tolR EG11011 putative inner membrane protein; involved in the tonB-independent uptake of group A colicins 775565-776830 + CDS tolA EG11007 membrane spanning protein; required for outer membrane integrity 776963-778255 + CDS tolB EG11008 periplasmic protein involved in the tonb-independent uptake of group A colicins

Reported regulatory sites for tolA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.808 775535-775551 gcggg TAACAGGCGAACAGTTT ttgga - 0 - 2.312 775513-775532 cgttt CCCTTGCTTGAAAGAGAGCG ggtaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back