torS

Information for torS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1051512-1052585 - CDS yccM EG13234 orf; hypothetical protein 1052657-1055371 - CDS torS EG12617 sensor protein torS (regulator TorR) 1055484-1056512 + CDS torT EG12616 part of regulation of tor operon; periplasmic

Reported regulatory sites for torS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.106 1055447-1055470 R catca ATAATAAGGCTTTATGCTAGATGC attcc - 0 - 0.098 1055395-1055413 R cctaa AGTGCACCGACCGTGAATT taacc - 0 -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back