torT

Information for torT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1052657-1055371 - CDS torS EG12617 sensor protein torS (regulator TorR) 1055484-1056512 + CDS torT EG12616 part of regulation of tor operon; periplasmic 1056485-1057177 - CDS torR EG12615 response transcriptional regulator for torA (sensor TorS)

Reported regulatory sites for torT: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.470 1055452-1055472 gcatc TAGCATAAAGCCTTATTATTG atgag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back