tpiA

Information for tpiA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4107510-4108265 + CDS cdh EG10138 CDP-diacylglycerol phosphotidylhydrolase 4108320-4109087 - CDS tpiA EG11015 triosephosphate isomerase 4109195-4109794 - CDS yiiQ EG11874 orf; hypothetical protein

Reported regulatory sites for tpiA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.448 4109174-4109196 R taaat GACAAAAAGCAAAGCCTTTGTGC cgatg - 0 - 2.448 4109150-4109172 R gtgcc GATGAATCTCTATACTGTTTCAC agacc - 0 - 0.552 4109089-4109105 R gctta TAAGCGTGGAGAATTAA aatgc - 0 - 0.166 4109121-4109144 R agacc TGCTGCCCTGCGGGGCGGCCATCT tcctt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back