treA

Information for treA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1244383-1244823 + CDS ycgY EG14275 orf; hypothetical protein 1244902-1246599 - CDS treA EG11017 trehalase; periplasmic 1246919-1248340 - CDS ycgC EG12399 putative PTS system enzyme I

Reported regulatory sites for treA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.084 1246653-1246676 R catgc AGCTAGTGCGATCCTGAACTAAGG ttttc - 0 - 0.973 1246771-1246792 R caacg CCGCTGGCTGGCTAATAAACAG acgtt - 0 - 0.552 1246693-1246714 R tctaa AATGCCTGACAGTTCGCAGAAT gagat - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back