treR

Information for treR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4462333-4463754 - CDS treB EG12127 PTS system enzyme II; trehalose specific 4463873-4464820 - CDS treR EG12202 repressor of treA;B;C 4465199-4467895 + CDS mgtA EG12525 Mg2+ transport ATPase; P-type 1

Reported regulatory sites for treR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.069 4465158-4465174 R tctga AACAGTACAGAAATGTC ttcag - 0 - 1.015 4464939-4464961 R aggag AATCCAATAATATTCGTAGCATC tatgg - 0 - 1.015 4464888-4464910 R caact AAACCAACGATAAACCAGACTTT accca - 0 - 0.447 4465094-4465115 R ctgag CAGGGACGTTAAAACGTCACGG cctta - 0 - 0.447 4465033-4465054 R cttac CGGAAAAGTTTTAATCTCCGTC gaggg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back