trg

Information for trg, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1489986-1490153 - CDS b1420 - orf; hypothetical protein 1490494-1492134 + CDS trg EG11018 methyl-accepting chemotaxis protein III; ribose sensor receptor 1492172-1493236 - CDS b1422 EG13752 putative transcriptional regulator LYSR-type

Reported regulatory sites for trg: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.995 1490258-1490281 atgag GTTTCCTTAGGGACGAAAATAATC acttc - 0 - 0.995 1490450-1490473 gtgcc GATGACTTTCTATCAGGAGTAAAC ctgga - 0 - 0.629 1490423-1490439 ttttt GGTCATAAGTAATTACC gtcaa - 0 - 0.587 1490388-1490405 tgcaa TAATTGTTGTAAAAATGT gacgc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back