trpE

Information for trpE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1317813-1319408 - CDS trpD EG11027 anthranilate synthase component II; glutamine amidotransferase and phosphoribosylanthranilate transferase 1319408-1320970 - CDS trpE EG11028 anthranilate synthase component I 1321062-1321106 - CDS trpL EG11274 trp operon leader peptide

Reported regulatory sites for trpE: Genome coordinates Source Transcription factor Transcription factor annotation 1321132-1321155 DPInteract trpR regulator for trp operon and aroH; trp aporepressor 1320999-1321079 Neidhardt (2nd edition) E.coli and Salmonella stem-loop attenuation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.885 1321135-1321152 R tcatc GAACTAGTTAACTAGTAC gcaag trpR 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.422 1320993-1321012 R cccgc CTAATGAGCGGGCTTTTTTT tgaac stem-loop 14 - 1.923 1320983-1320999 R cgggc TTTTTTTTGAACAAAAT tagag stem-loop 1 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back