trxA

Information for trxA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3961980-3963245 - CDS rhlB EG10844 putative ATP-dependent RNA helicase 3963322-3963705 + CDS trxA EG11031 thioredoxin 1 3963846-3963947 + CDS rhoL - rho operon leader peptide

Reported regulatory sites for trxA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.346 3963266-3963288 cagct TACTATTGCTTTACGAAAGCGTA tccgg - 0 - 5.472 3963248-3963264 catag TGTGGTAGAATATCAGC ttact - 0 - 5.472 3963292-3963308 tatcc GGTGAAATAAAGTCAAC cttta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back