trxB

trxB

Information for trxB, and also upstream and downstream flanking genes:

Genome coordinates	Orientation	Gene type	Name	EcoGene	Annotation
928419-930185	-	CDS	cydD	EG11405	ATP-binding component of cytochrome-related transport; Zn sensitive
930308-931273	-	CDS	trxB	EG11032	thioredoxin reductase
931818-932312	+	CDS	lrp	EG10547	regulator for leucine (or lrp) regulon and high-affinity branched-chain amino acid transport system

Reported regulatory sites for trxB:

Genome coordinates

Source

Transcription factor

Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05):

Avg. MAP

Genome coordinates

Sequence

Site type

Overlap (bp)

Repeat

Model logo

Prediction logo

Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05):

Avg. MAP	Genome coordinates	Sequence	Site type	Overlap (bp)	Repeat	Model logo	Prediction logo	Prediction alignment
2.710	931348-931363 R	tgcac AAATTGTTAACAAAAT cgtca	-	0	-
2.710	931307-931322 R	tctgt AAATTCCCTACAATCC tgccc	-	0	-
2.518	931659-931682 R	gaaga CCGTTGCCTTGTGGCAGCTATCGA catca	-	0	-
2.518	931280-931303 R	cctgc CCATTGTCTGCCAACAACTATGGG gatct	-	0	-
2.386	931528-931548 R	tcctc GAATGTTTTCGCAAAACACCA gggga	-	0	-
2.386	931504-931524 R	caggg GATTGTCAAAGCAAAACATCG atttt	lrp	21	-

Critical MAP values: