trxC

Information for trxC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2715511-2716548 - CDS yfiF EG11786 orf; hypothetical protein 2716755-2717174 + CDS trxC EG11887 putative thioredoxin-like protein 2717219-2717941 + CDS yfiP EG14223 orf; hypothetical protein

Reported regulatory sites for trxC: Genome coordinates Source Transcription factor Transcription factor annotation 2716619-2716661 PMID: 10644706 oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.780 2716607-2716630 gttcg CCATGATTTCGTACCAAAGCCTGC gacta oxyR 12 - 3.333 2716683-2716701 ccccg ATAATATGTAACATATTAG aaaca - 0 - 3.145 2716566-2716582 cagcg CTGCGCGAAGCGCGCAG attac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back