tsf

Information for tsf, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 189874-190599 + CDS rpsB EG10901 30S ribosomal subunit protein S2 190857-191708 + CDS tsf EG11033 protein chain elongation factor EF-Ts 191855-192580 + CDS pyrH EG11539 uridylate kinase

Reported regulatory sites for tsf: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.898 190774-190794 ggtta GGGGGCCTGCATATGGCCCCC ttttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.540 190617-190632 actcc CCCAAAATAGTTCGAG ttgca - 0 IRU2 (16) 2.540 190720-190735 tgcgg CGCGAAATATGAAGGG ggaga - 0 IRU2 (16) 2.262 190742-190757 gagag CCCTTATAGACCAGGT agtac - 0 - 2.262 190800-190815 ttttt CACTTTTATATCTGTG cggtt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back