tsr

Information for tsr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4586699-4588864 - CDS yjiY EG12586 putative carbon starvation protein 4589227-4590882 + CDS tsr EG11034 methyl-accepting chemotaxis protein I; serine sensor receptor 4590931-4592292 - CDS yjiZ EG12588 putative transport protein; cryptic; orf; joins former yjiZ and yjjL

Reported regulatory sites for tsr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.973 4589181-4589197 ttttc CTTTCCAGGCCGAAAAT cttgc - 0 - 3.538 4589060-4589079 ataaa TATGTGATTCATATCACATA tttat - 0 - 1.564 4588968-4588983 cgcgt AAAGTAAGGTAAATAA ctgag - 0 - 1.564 4589093-4589108 gtgaa TAATTTATGTAAATAA tggct - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back