tsx

Information for tsx, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 429829-430176 + CDS yajD EG11097 orf; hypothetical protein 430353-431237 - CDS tsx EG11035 nucleoside channel; receptor of phage T6 and colicin K 431536-432135 - CDS yajI EG12874 orf; hypothetical protein

Reported regulatory sites for tsx: Genome coordinates Source Transcription factor Transcription factor annotation 431384-431405 DPInteract crp cyclic AMP receptor protein 431345-431366 DPInteract crp cyclic AMP receptor protein 431355-431372 DPInteract cytR regulator for deo operon udp cdd tsx nupC and nupG

Species with an ortholog: SP ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.272 431368-431387 R aacgc AATCGATTACGTAAATGATA gaact cytR crp 5 4 - 4.272 431257-431276 R gcctt TTTCACTCCCGCAAGGGATT ttcaa - 0 - 2.997 431329-431352 R acgaa ACATATTTTTGTGAGCAATGATTT ttata crp 8 - 2.997 431281-431304 R atacg AAATATTTAGAAACGCAATTTGCG ccttt - 0 - 2.076 431513-431536 R cagta AACGTATTTCGGGACGATTTTGTG cgtcc - 0 - 2.076 431481-431504 R cccgc AACATCTTTCCCCGTCATTTTGTT actct - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back