ttdA

Information for ttdA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3202965-3203897 - CDS ygiP EG12694 putative transcriptional regulator LYSR-type 3204104-3205015 + CDS ttdA EG11168 L-tartrate dehydratase; subunit A 3205012-3205617 + CDS ttdB EG11169 L-tartrate dehydratase; subunit B

Reported regulatory sites for ttdA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.560 3203925-3203948 taagc GCAGTGTATTTCGCAAAACATTGC cattc - 0 - 0.406 3204060-3204083 agttt GTGGCGGTGAATTTTTCCAGACAA ataca - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back