tyrB

Information for tyrB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4263361-4264440 + CDS alr EG10001 alanine racemase 1 4264693-4265886 + CDS tyrB EG11040 tyrosine aminotransferase; tyrosine repressible 4266993-4267706 + CDS aphA EG11934 diadenosine tetraphosphatase

Reported regulatory sites for tyrB: Genome coordinates Source Transcription factor Transcription factor annotation 4264669-4264690 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 4264692-4264713 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.684 4264617-4264633 tcctg AACATCCACTCGATCTT cgcct - 0 - 1.671 4264500-4264517 gccaa TAAAATCCTAAAAATTCA ataag - 0 REP318a (1) 1.520 4264475-4264498 ggatg CGGCGTGAATGCCTTATCCGGCCA ataaa - 0 REP318a (24)

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back