tyrP

Information for tyrP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1987274-1987513 - CDS yecH EG12863 orf; hypothetical protein 1987704-1988915 + CDS tyrP EG11041 tyrosine-specific transport system 1988977-1989642 - CDS yecA EG11139 orf; hypothetical protein

Reported regulatory sites for tyrP: Genome coordinates Source Transcription factor Transcription factor annotation 1987616-1987637 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 1987593-1987614 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.033 1987593-1987614 ttttt ATTGTACATTTATATTTACACC atatg tyrR 22 - 4.033 1987616-1987637 cacca TATGTAACGTCGGTTTGACGAA gcagc tyrR 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.143 1987654-1987670 gcctt AACCTGCGCCGCAGATA tcact - 0 - 0.889 1987560-1987575 atgaa GACTTTGCGCCAGCGC aggac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back