tyrR

Information for tyrR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1383535-1384596 + CDS ycjF EG12870 orf; hypothetical protein 1384744-1386285 + CDS tyrR EG11042 transcriptional regulation of aroF; aroG; tyrA and aromatic amino acid transport 1386329-1386835 - CDS tpx EG12672 thiol peroxidase

Reported regulatory sites for tyrR: Genome coordinates Source Transcription factor Transcription factor annotation 1384654-1384675 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 1384610-1384631 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.722 1384655-1384674 tcttt GTGTCAATGATTGTTGACAG aaacc tyrR 20 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.606 1384691-1384708 ctatc CAAATAGTGTCATATCAT catat - 0 - 1.606 1384713-1384730 tcata TTAATTGTTCTTTTTTCA ggtga - 0 - 1.332 1384631-1384649 tacgc CGAAGTGCCCGTTTTTCCG tcttt tyrR 1 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back