tyrS

Information for tyrS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1713050-1713913 - CDS pdxY EG13940 pyridoxal kinase 2 / pyridoxine kinase 1713972-1715246 - CDS tyrS EG11043 tyrosine tRNA synthetase 1715375-1716031 - CDS pdxH EG11487 pyridoxinephosphate oxidase

Reported regulatory sites for tyrS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.868 1715316-1715339 R gtact CCTGATTCTGGCACTTTATTCTAT gtctc - 0 - 1.868 1715256-1715279 R ccggc AAAGGTGCAGTCGTTATATACATG gagat - 0 - 1.792 1715357-1715374 R cctga AAAGATGCAAAAATCTTG cttta - 0 - 1.737 1715293-1715314 R ctatg TCTCTTTCGCATCTGGCGAAAA gtcgt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back