ubiC

Information for ubiC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4248534-4249862 + CDS yjbI EG11927 orf; hypothetical protein 4249974-4250582 + CDS ubiC EG11369 chorismate lyase 4250595-4251467 + CDS ubiA EG11370 4-hydroxybenzoate-octaprenyltransferase

Reported regulatory sites for ubiC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.507 4249919-4249938 gttgc CCTCGCCAGCACGGGCATCG gtaaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back