ubiG

Information for ubiG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2334813-2337440 - CDS gyrA EG10423 DNA gyrase; subunit A; type II topoisomerase 2337587-2338309 + CDS ubiG EG11143 3-demethylubiquinone-9 3-methyltransferase and 2-octaprenyl-6-hydroxy phenol methylase 2338437-2342189 - CDS yfaL EG12850 putative ATP-binding component of a transport system

Reported regulatory sites for ubiG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.891 2337443-2337464 catct AACCGCTATCCCTCTACTGTAT cccgg - 0 - 0.874 2337469-2337492 tcccg GATTCAAAGGTCGCAAATTATAAC acagc - 0 - 0.838 2337499-2337522 cagcc GCGCAGTTTGAGGTAAACCTATAC gcttt fis 24 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back