ubiX

Information for ubiX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2425029-2425811 - CDS argT EG10072 lysine-; arginine-; ornithine-binding periplasmic protein 2426077-2426646 - CDS ubiX EG11044 3-octaprenyl-4-hydroxybenzoate carboxy-lyase 2426741-2428258 - CDS purF EG10794 amidophosphoribosyltransferase = PRPP amidotransferase

Reported regulatory sites for ubiX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.882 2426712-2426735 R tgcct TCGCTGAGGGTGCCGGTCTGGCAC cctga - 0 - 0.882 2426653-2426676 R aaagt CTGCCTGCAAGTCTGACAGGGCAA ctatt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back