ucpA

Information for ucpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2540532-2541548 - CDS cysP EG10195 thiosulfate binding protein 2541852-2542709 - CDS ucpA EG12133 putative oxidoreductase 2542772-2543629 - CDS yfeT EG14161 orf; hypothetical protein

Reported regulatory sites for ucpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.825 2542713-2542736 R cctga ATTAGTGAGCTGATCCGCAGCAAT atttt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back