udhA

Information for udhA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4156069-4156986 + CDS oxyR EG10681 activator; hydrogen peroxide-inducible genes 4156969-4158303 - CDS udhA EG11428 putative oxidoreductase 4158646-4159350 + CDS yijC EG11394 orf; hypothetical protein

Reported regulatory sites for udhA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.647 4158384-4158404 R attct GTTGCTTTTATGTATAAGAAC aggta - 0 - 3.310 4158306-4158328 R ggttc CGGCCCCGGCGGCGAAGGCGCTG caatg - 0 - 2.762 4158333-4158355 R tccta CGATTACGATGCCATAGTAATAG gttcc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back