udk

Information for udk, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2139656-2140237 - CDS dcd EG11418 2'-deoxycytidine 5'-triphosphate deaminase 2140329-2141024 - CDS udk EG11701 uridine/cytidine kinase 2141288-2144605 + CDS yegE EG12396 putative sensor-type protein

Reported regulatory sites for udk: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.866 2141194-2141216 R tacat TTTATATGCGAATTGCTCATAAA gtgac - 0 - 2.452 2141030-2141046 R cggat GAAATCCCTATAATTGC cgcgt - 0 - 2.089 2141226-2141243 R tctgt GTTTATGCTAGTACAAAA gtttt - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back