udp

Information for udp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4012721-4013719 - CDS ysgA EG14321 putative enzyme 4014018-4014779 + CDS udp EG11045 uridine phosphorylase 4014920-4016347 + CDS yigN EG11472 putative alpha helix chain

Reported regulatory sites for udp: Genome coordinates Source Transcription factor Transcription factor annotation 4013926-4013944 PMID: 8626289 & RegulonDB crp cyclic AMP receptor protein 4013874-4013892 PMID: 8626289 & RegulonDB crp cyclic AMP receptor protein 4013907-4013924 DPInteract cytR regulator for deo operon udp cdd tsx nupC and nupG

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.601 4013873-4013896 ggtga TTTATGTGATTTGCATCACTTTTG gtggg crp 19 - 4.601 4013925-4013948 ttgcg TCATGGTGATGAGTATCACGAAAA aatgt crp 19 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.839 4013811-4013827 agcat GCAACAAATCACATTGC ctgaa - 0 - 2.839 4013965-4013981 cttcg GTAAAGTGTCTTTTTGC ttctt - 0 - 2.244 4013776-4013797 cctta TAAAAATGTTGCGCAATGTTAA ctata - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back