ugpA

Information for ugpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3586813-3587658 - CDS ugpE EG11049 sn-glycerol 3-phosphate transport system; integral membrane protein 3587655-3588542 - CDS ugpA EG11046 sn-glycerol 3-phosphate transport system; integral membrane protein 3588640-3589956 - CDS ugpB EG11047 sn-glycerol 3-phosphate transport system; periplasmic binding protein

Reported regulatory sites for ugpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.937 3588553-3588569 R gcgca TCCGGCACAGTTCAGGA attaa - 0 REPv257a (6) 2.216 3588600-3588623 R tcgga TGCGTTTCGCTTATCTGACCTGGC atcgc - 0 REPv257b (23) 2.216 3588570-3588593 R tcgcg TGTAGGCCGGATAAGCGAAGCGCA tccgg - 0 REPv257a (23)

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back