ugpB

Information for ugpB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3587655-3588542 - CDS ugpA EG11046 sn-glycerol 3-phosphate transport system; integral membrane protein 3588640-3589956 - CDS ugpB EG11047 sn-glycerol 3-phosphate transport system; periplasmic binding protein 3590355-3591080 - CDS livF EG10536 ATP-binding component of leucine transport

Reported regulatory sites for ugpB: Genome coordinates Source Transcription factor Transcription factor annotation 3590071-3590092 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC) 3590049-3590070 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC) 3590027-3590048 DPInteract phoB positive response regulator for pho regulon sensor is PhoR (or CreC)

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.269 3590034-3590054 R atgta ACAAAAAAGTTATTTTTCTGT aattc phoB 21 - 5.227 3589981-3589998 R ataaa ACGCGTGAATTCGCGCAT tcggt - 0 - 4.068 3590010-3590032 R ctgta ATTCGAGCATGTCATGTTACCCC gcgag phoB 6 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back