uhpT

Information for uhpT, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3841591-3843357 + CDS yicP EG11692 probable adenine deaminase (synthesis xanthine) 3843403-3844794 - CDS uhpT EG11054 hexose phosphate transport protein 3844932-3846254 - CDS uhpC EG11053 regulator of uhpT

Reported regulatory sites for uhpT: Genome coordinates Source Transcription factor Transcription factor annotation 3844919-3844939 PMID: 10512697 crp cyclic AMP receptor protein 3844857-3844904 PMID: 10512697 uhpA response regulator positive activator of uhpT transcription (sensor uhpB)

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.103 3844878-3844900 R cggca AAACTAAGAAATTTTCCAGGTTT tgcct uhpA 23 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.694 3844813-3844833 R ttaca ATGCATGCCTCACGCAGGTAT tcatt - 0 - 1.828 3844857-3844876 R gtttt GCCTGGACGCTATCTCAGGC ctgat uhpA 20 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back