umuD

Information for umuD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1228706-1229623 - CDS hlyE EG13243 hemolysin E 1229990-1230409 + CDS umuD EG11057 SOS mutagenesis; error-prone repair; processed to UmuD'; forms complex with UmuC 1230409-1231677 + CDS umuC EG11056 SOS mutagenesis and repair

Reported regulatory sites for umuD: Genome coordinates Source Transcription factor Transcription factor annotation 1229951-1229970 DPInteract lexA regulator for SOS(lexA) regulon

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.625 1229951-1229970 cagac TACTGTATATAAAAACAGTA taact lexA 20 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.000 1229753-1229769 taaat ATCAAACAATGTTTAAT gtcat fnr 9 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back