upp

Information for upp, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2616891-2618180 - CDS uraA EG12129 uracil transport 2618266-2618919 - CDS upp EG11332 uracil phosphoribosyltransferase 2619217-2620254 + CDS purM EG10798 phosphoribosylaminoimidazole synthetase = AIR synthetase

Reported regulatory sites for upp: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.374 2619137-2619154 R caggg AAAGCAAACGTTTGCGAG actgc purR 18 - 3.479 2619161-2619180 R aaaaa TAAAATTCGGCGCAATTCTA acagg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.966 2618926-2618948 R tgaag AAAGGAGGTATAATCCGTCGATT ttttt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back