usg

Information for usg, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2432844-2433656 - CDS truA EG10454 pseudouridylate synthase I 2433656-2434669 - CDS usg EG11059 putative PTS system enzyme II A component 2434735-2435871 - CDS pdxB EG10692 erythronate-4-phosphate dehyrogenase

Reported regulatory sites for usg: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.553 2434672-2434689 R tttgc TATTTCTGGAGTAAACCA ccatg - 0 - 0.651 2434706-2434727 R tcttc TTCATGCTCTCTGCTGTAACAT tggca - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back