ushA

Information for ushA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 502700-503920 - CDS fsr EG13268 fosmidomycin resistance protein 504138-505790 + CDS ushA EG11060 UDP-sugar hydrolase (5'-nucleotidase) 505827-506306 - CDS ybaK EG12454 orf; hypothetical protein

Reported regulatory sites for ushA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.252 503970-503991 tttgt GATTATTACCAGACTAACATAC ctgta - 0 - 1.378 504033-504055 tacag AATTTCTAATCTGGATGCAGATT tatct - 0 - 1.194 503948-503969 tgcga TGTAAAGAATGATCTTATTTGT gatta - 0 - 1.194 504100-504121 atact ATTTTTCAACACGTTGAAATCA ggtca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back