uxaB

Information for uxaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1606132-1607097 - CDS b1520 EG13813 orf; hypothetical protein 1607253-1608704 - CDS uxaB EG11065 altronate oxidoreductase 1608931-1609878 - CDS b1522 EG13814 orf; hypothetical protein

Reported regulatory sites for uxaB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.519 1608728-1608744 R tacca ATTCAAACAGGTTGTAT gacta - 0 - 0.580 1608787-1608810 R tgctc ATTAATCATCAGGAGTTGATCAAA acagg - 0 - 0.235 1608855-1608876 R atgat CCAGGAAAAGGCGTTTTTCCTC gatta - 0 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back