uxaC

Information for uxaC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3239467-3240954 - CDS uxaA EG12734 altronate hydrolase 3240969-3242381 - CDS uxaC EG12737 uronate isomerase 3242744-3244162 + CDS exuT EG12738 transport of hexuronates

Reported regulatory sites for uxaC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.396 3242615-3242633 R aaaga TAACTTGTCATACAACTTT aaaag - 0 - 3.396 3242434-3242452 R tctgg AAATTGGTGTGATAACTTT gtcag - 0 - 2.876 3242592-3242613 R cttta AAAGGTGAGAGCCATCACAAAT gtggg - 0 - 2.876 3242470-3242491 R ctacg TTTATTGATCTAACTCACGAAA atatc - 0 - 0.151 3242663-3242679 R tgaat CGGCAATTTGCATTCCG tcgac - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back