uxuR

Information for uxuR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4550470-4551930 + CDS uxuB EG20248 D-mannonate oxidoreductase 4552145-4552918 + CDS uxuR EG20249 regulator for uxu operon 4553059-4553889 - CDS yjiC EG12564 orf; hypothetical protein

Reported regulatory sites for uxuR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.682 4551952-4551969 cagac TTACTGGTCAATCAAACT gatat - 0 - 4.682 4551972-4551989 actga TATTTGGTTGACCAGTTT tcgtt - 0 - 0.771 4552026-4552041 tccag TGCTAATGGTATAGTT tgaga - 0 - 0.219 4552004-4552027 tgccc ACCTGTACGTGCCAACTTCCAGTG ctaat - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back