vacJ

Information for vacJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2461032-2462090 + CDS b2345 EG14130 orf; hypothetical protein 2462272-2463027 - CDS vacJ EG14276 lipoprotein precursor 2463321-2464253 + CDS yfdC EG12420 putative transport

Reported regulatory sites for vacJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.276 2463062-2463080 R gtatc GTTCCGTCATGGATGGCAA actgc - 0 - 1.028 2463135-2463155 R aaatc AGCAAATCAGGGCGTCTGGAC atcag - 0 - 1.028 2463084-2463104 R cccac ACCTAAACAGGCGGATACGGT atcgt - 0 - 0.883 2463270-2463291 R tatag CTAAAGCGTAGCGGCTTTTTTG ctcgc - 0 - 0.883 2463214-2463235 R tgtag AAAAGGCTGCGTTTGCCTTTTT ctgtt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back