wcaJ

Information for wcaJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2116702-2118180 - CDS wzxC EG13576 probable export protein 2118182-2119576 - CDS wcaJ EG13575 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase 2119631-2121001 - CDS cpsG EG10162 phosphomannomutase

Reported regulatory sites for wcaJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.319 2119596-2119619 R atctt CCCTTACCCCACTGCGGGTAAGGG gctaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.121 2119578-2119595 R aaggg GCTAATAACAGGAACAAC gatga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back