wcaK

Information for wcaK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2113929-2115149 - CDS wcaL EG12652 putative colanic acid biosynthesis glycosyl transferase 2115146-2116426 - CDS wcaK EG13577 putative galactokinase (EC 2.7.1.6). 2116702-2118180 - CDS wzxC EG13576 probable export protein

Reported regulatory sites for wcaK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.555 2116588-2116611 R ggcct GATAAGACGCGTCAGCGTCGCATC aggca - 0 REP144c (24) 5.555 2116492-2116515 R ggcct GATAAGACGCGTCAGCGTCGCATC aggca - 0 REP144a (24) 1.848 2116668-2116686 R tcggt TCCGACAACGGTTGCCGGA tgcgg - 0 REP144d (6) - 1.784 2116641-2116656 R gtaaa ACGCCTTATCCGTCCT acggt - 0 REP144d (16) 1.784 2116545-2116560 R cgtga ACGCCTTATCCGTCCT acggt - 0 REP144b (16)

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back